Streptomyces fagopyri: GFH48_20445 Help Entry GFH48_20445       CDS       T06986                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism sfy  Streptomyces fagopyri Pathway sfy00253   Tetracycline biosynthesis sfy01056   Biosynthesis of type II polyketide backbone sfy01100   Metabolic pathways sfy01110   Biosynthesis of secondary metabolites Module sfy_M00778   Type II polyketide backbone biosynthesis, acyl-CoA + malonyl-CoA => polyketide Brite KEGG Orthology (KO) [BR:sfy00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     GFH48_20445    00253 Tetracycline biosynthesis     GFH48_20445  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:sfy01004]     GFH48_20445    01008 Polyketide biosynthesis proteins [BR:sfy01008]     GFH48_20445 Lipid biosynthesis proteins [BR:sfy01004]  Polyketide synthase   Component type    GFH48_20445 Polyketide biosynthesis proteins [BR:sfy01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      GFH48_20445     Nonaketide PKS      GFH48_20445     Decaketide PKS      GFH48_20445 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  QFZ75322 UniProt:  A0A5Q0LDZ8 LinkDB All DBs Position complement(4690098..4690373) Genome browser AA seq 91 aa AA seqDB search MSTSEFTLDDLRRILLEGAGVDEGVDLDGDILDEPFEVLGYESLALLETGSRIEREYGIV LDEDLLTDADTPRALIEAVNQQFGADEPAAA NT seq 276 nt NT seq  +upstreamnt  +downstreamnt gtgtccacttcggaattcaccctggacgacctgcgccgcatcctgctggagggcgcgggc gtcgacgagggcgtcgacctcgacggcgacatcctcgacgagccgttcgaagtcctcggc tacgagtcgctggccctgctggagaccggcagccgcatcgagcgcgagtacgggatcgtc ctcgacgaggacctgctgaccgacgccgacaccccgcgcgccctcatcgaggccgtgaac cagcagttcggcgccgacgagcccgccgccgcctga

DBGET integrated database retrieval system