Streptomyces griseofuscus: HEP81_03175 Help Entry HEP81_03175       CDS       T07010                                  Name (GenBank) chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism sgf  Streptomyces griseofuscus Pathway sgf00400   Phenylalanine, tyrosine and tryptophan biosynthesis sgf01100   Metabolic pathways sgf01110   Biosynthesis of secondary metabolites sgf01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:sgf00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     HEP81_03175 Enzymes [BR:sgf01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      HEP81_03175 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Motif Other DBs NCBI-ProteinID:  QNT93486 UniProt:  A0A1X4GTD5 LinkDB All DBs Position 3586763..3587041 Genome browser AA seq 92 aa AA seqDB search MSTTTPEETAATPEATIAAARERIDAIDDRIIGLIQERTAVSAVVQQTRISSGGRRVSLS REMEILGHYREALGKPGTSLAMTLLELCRGRI NT seq 279 nt NT seq  +upstreamnt  +downstreamnt atgagcaccaccacccccgaagagaccgccgcgacgccggaggcgaccatcgccgccgcg cgggagcgcatcgacgcgatcgacgaccggatcatcggcctcatccaggagcggacggcc gtctccgccgtggtccagcagacccgtatctcctccggcgggcggcgggtcagcctctcc cgcgagatggagatcctcggccactaccgcgaggcgctgggcaagcccggcacctcgctc gccatgaccctgctggagctgtgccggggccgtatctga

DBGET integrated database retrieval system