Schistocerca gregaria (desert locust): 126335937 Help Entry 126335937         CDS       T08688                                  Name (RefSeq) defensin-like   KO K20668   defensin Organism sgre  Schistocerca gregaria (desert locust) Pathway sgre04624   Toll and Imd signaling pathway Brite KEGG Orthology (KO) [BR:sgre00001]  09150 Organismal Systems   09151 Immune system    04624 Toll and Imd signaling pathway     126335937  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02000 Transporters [BR:sgre02000]     126335937 Transporters [BR:sgre02000]  Other transporters   Pores ion channels [TC:1]    126335937 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Defensin_2 Motif Other DBs NCBI-GeneID:  126335937 NCBI-ProteinID:  XP_049855370 LinkDB All DBs Position 2:693303989..693310550 Genome browser AA seq 77 aa AA seqDB search MRSFITFVLLALVAIPAITSAAPVAGEDGHGDRHVRATCDLLSAFGVGDSACAARCIGTR KGFRGGYCDKGVCHCRK NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgagaagctttataactttcgttcttctcgccctggtcgccatcccggctattacatct gctgctccagtggcaggggaggatggtcacggcgaccgccacgtgcgcgccacgtgtgac ctgctgagtgccttcggcgtaggggactctgcctgcgccgcgcgctgcatcggcacgcgg aaaggcttcaggggcggctactgcgataagggcgtctgccactgccgaaagtag

DBGET integrated database retrieval system