Syntrophobotulus glycolicus: Sgly_1559 Help Entry Sgly_1559         CDS       T01429                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism sgy  Syntrophobotulus glycolicus Pathway sgy01100   Metabolic pathways sgy01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sgy00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Sgly_1559    00074 Mycolic acid biosynthesis     Sgly_1559   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Sgly_1559 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ADY55859 UniProt:  F0SXM6 LinkDB All DBs Position complement(1579001..1579228) Genome browser AA seq 75 aa AA seqDB search MDNKFITIVAHTLKVDPKTLNENSTADVTPGWDSLMHWVVISELEDIYEVEFTMDEATSF KNLGDIYTTLMKKLS NT seq 228 nt NT seq  +upstreamnt  +downstreamnt gtggacaataaatttataaccattgttgcccatacactaaaggttgaccccaagactctt aatgaaaactctacggcagatgtgacacctggctgggactccctgatgcattgggtggtc atcagcgaattggaagatatctatgaagttgaatttactatggatgaagccacttcattc aaaaacctcggtgacatttacaccaccctgatgaaaaaactctcttga

DBGET integrated database retrieval system