Shinella sp. XGS7: LHJ69_17470 Help Entry LHJ69_17470       CDS       T10581                                  Symbol zapB Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism shin  Shinella sp. XGS7 Brite KEGG Orthology (KO) [BR:shin00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:shin03036]     LHJ69_17470 (zapB) Chromosome and associated proteins [BR:shin03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LHJ69_17470 (zapB) SSDB OrthologParalogGFIT Motif Pfam:  ZapB ZapB_rel BEGAIN_coil Cep57_CLD_2 CEP135_TSGA10_CC ATG14 CC_Bre1 DUF8429 Spectrin CEP131_CC DUF4164 HTH_pico_cyano CENPU Rootletin DUF720 DUF7776 Motif Other DBs NCBI-ProteinID:  UDF34361 LinkDB All DBs Position 3790696..3790911 Genome browser AA seq 71 aa AA seqDB search MPSITDLLDRVERLLLRHEELQRTNALLQEQLQAVGHERDQLRSRLSAARQRIDALLERL PVESETARNEK NT seq 216 nt NT seq  +upstreamnt  +downstreamnt atgcctagcatcaccgacctgctcgaccgcgtcgagcgcctgctgctgcgtcatgaggag ctccagcgcaccaacgcgctgctgcaggagcagttgcaggccgtgggccatgagcgcgac cagctgcgctcgcgcctgtcggcggcccgccagcgcatcgacgccctgctggagcggctt cccgtcgagagcgaaaccgccaggaacgagaagtag

DBGET integrated database retrieval system