Sturnira hondurensis: 118990377 Help Entry 118990377         CDS       T07222                                  Symbol CXCL10 Name (RefSeq) C-X-C motif chemokine 10   KO K12671   C-X-C motif chemokine 10 Organism shon  Sturnira hondurensis Pathway shon04060   Cytokine-cytokine receptor interaction shon04061   Viral protein interaction with cytokine and cytokine receptor shon04062   Chemokine signaling pathway shon04620   Toll-like receptor signaling pathway shon04622   RIG-I-like receptor signaling pathway shon04623   Cytosolic DNA-sensing pathway shon04657   IL-17 signaling pathway shon04668   TNF signaling pathway shon05160   Hepatitis C shon05164   Influenza A shon05169   Epstein-Barr virus infection shon05171   Coronavirus disease Brite KEGG Orthology (KO) [BR:shon00001]  09130 Environmental Information Processing   09132 Signal transduction    04668 TNF signaling pathway     118990377 (CXCL10)   09133 Signaling molecules and interaction    04060 Cytokine-cytokine receptor interaction     118990377 (CXCL10)    04061 Viral protein interaction with cytokine and cytokine receptor     118990377 (CXCL10)  09150 Organismal Systems   09151 Immune system    04620 Toll-like receptor signaling pathway     118990377 (CXCL10)    04622 RIG-I-like receptor signaling pathway     118990377 (CXCL10)    04623 Cytosolic DNA-sensing pathway     118990377 (CXCL10)    04657 IL-17 signaling pathway     118990377 (CXCL10)    04062 Chemokine signaling pathway     118990377 (CXCL10)  09160 Human Diseases   09172 Infectious disease: viral    05160 Hepatitis C     118990377 (CXCL10)    05171 Coronavirus disease     118990377 (CXCL10)    05164 Influenza A     118990377 (CXCL10)    05169 Epstein-Barr virus infection     118990377 (CXCL10)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04052 Cytokines and neuropeptides [BR:shon04052]     118990377 (CXCL10)    00536 Glycosaminoglycan binding proteins [BR:shon00536]     118990377 (CXCL10) Cytokines and neuropeptides [BR:shon04052]  Cytokines   Chemokines    118990377 (CXCL10) Glycosaminoglycan binding proteins [BR:shon00536]  Heparan sulfate / Heparin   Chemokines    118990377 (CXCL10) SSDB OrthologParalogGFIT Motif Pfam:  IL8 DUF8408 Motif Other DBs NCBI-GeneID:  118990377 NCBI-ProteinID:  XP_036906866 LinkDB All DBs Position Unknown AA seq 103 aa AA seqDB search MNQSALLIFCLILLTLSGAQGIPLSRTTRCTCISISTRSVNPGSLAKLEVIPASQSCPRV EIIATMKSGEKRCLNLESKIVKNVLKALSNKQRLKSSSTQSKA NT seq 312 nt NT seq  +upstreamnt  +downstreamnt atgaaccaaagtgctcttcttattttctgccttatccttctgactctgagtggagctcaa ggaatacctctctctagaactacacgctgtacctgcatcagtattagtactaggtctgta aatccaggttccttagcaaaacttgaagtgattcctgcaagtcaatcttgtccacgtgtt gagatcatagccacaatgaaaagtggggaaaaaagatgtctgaatctagagtccaagatc gtcaagaatgtgctgaaagcacttagcaacaagcaaagattgaaaagctcttcaacccag agcaaagcataa

DBGET integrated database retrieval system