Sarcophilus harrisii (Tasmanian devil): 102466508 Help Entry 102466508         miRNA     T02286                                  Symbol MIR30C Name (RefSeq) sha-miR-30c   KO K17110   microRNA 30 Organism shr  Sarcophilus harrisii (Tasmanian devil) Pathway shr05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:shr00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     102466508 (MIR30C)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:shr04147]     102466508 (MIR30C)   09184 RNA family    03100 Non-coding RNAs [BR:shr03100]     102466508 (MIR30C) Exosome [BR:shr04147]  Exosomal RNA   Exosomal RNA of breast milk    102466508 (MIR30C)   Exosomal RNA of hepatic cancer cells    102466508 (MIR30C)   Exosomal RNA of lung cancer cells    102466508 (MIR30C) Non-coding RNAs [BR:shr03100]  Other eukaryotic RNA   Micro RNA    102466508 (MIR30C) SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  102466508 Ensembl:  ENSSHAG00000019388 miRBase:  MI0019635 LinkDB All DBs Position 3:545754680..545754703 Genome browser NT seq 24 nt NT seq  +upstreamnt  +downstreamnt tgtaaacatcctacactctcagct

DBGET integrated database retrieval system