Shouchella hunanensis: PQ477_20315 Help Entry PQ477_20315       CDS       T09126                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism shua  Shouchella hunanensis Pathway shua00998   Biosynthesis of various antibiotics shua01100   Metabolic pathways shua01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:shua00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PQ477_20315 (acpP)    00074 Mycolic acid biosynthesis     PQ477_20315 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PQ477_20315 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF1493 ACP_SdgA_C PRC Motif Other DBs NCBI-ProteinID:  WDF03806 UniProt:  A0ABY7W8H3 LinkDB All DBs Position complement(3959624..3959857) Genome browser AA seq 77 aa AA seqDB search MADVMERVTKIVVDRLGVEESEVTLEASFKDDLKADSLDVVELVMELEDEFDMEIADEDA EKIATVKDVVDYINNNA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt gtggctgacgtaatggagcgcgtaacgaaaatcgtcgttgaccgtttaggtgtagaagaa tcagaagtaacgcttgaggcatcttttaaagacgatcttaaagctgactcacttgatgtg gtggagcttgtaatggagcttgaagatgagttcgacatggaaattgctgatgaagacgca gaaaaaattgcaacggttaaggatgttgtcgattacataaataacaacgcataa

DBGET integrated database retrieval system