Streptomyces hundungensis: DWB77_00463 Help Entry DWB77_00463       CDS       T07388                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism shun  Streptomyces hundungensis Pathway shun00998   Biosynthesis of various antibiotics shun01100   Metabolic pathways shun01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:shun00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     DWB77_00463    00074 Mycolic acid biosynthesis     DWB77_00463   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     DWB77_00463 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AYG78356 UniProt:  A0A387H3T9 LinkDB All DBs Position 477869..478129 Genome browser AA seq 86 aa AA seqDB search MTRSEVRTVLLDAVRELRPEFAGLRLTGNEHLGAELGLDSVARVELLVVLEEEFGIEDEV DPRIFMTPATVNALVDQIVVAEGVCR NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atgaccaggtcggaggtccggaccgtcctcctggacgcggtacgggagttgcggcccgag ttcgccggactgcggctcaccggtaacgagcacctcggcgcggagctggggctggactcg gtggcgcgggtggagcttctggtggtgttggaggaggagttcgggatcgaggacgaggtg gacccgcggatcttcatgacgcccgcgacggtcaacgcgctcgtggaccagatcgtggtg gccgagggcgtctgccggtga

DBGET integrated database retrieval system