Streptococcus ilei I-G2: N596_09325 Help Entry N596_09325        CDS       T02879                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism sig  Streptococcus ilei I-G2 Pathway sig01100   Metabolic pathways sig01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sig00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     N596_09325    00074 Mycolic acid biosynthesis     N596_09325   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     N596_09325 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding TerB DUF6137 PRF Motif Other DBs NCBI-GeneID:  17317097 NCBI-ProteinID:  AGY40920 LinkDB All DBs Position 1904315..1904539 Genome browser AA seq 74 aa AA seqDB search MAVFEKVQEIIVEELGKEPSEVTLESTFEDLEADSLDLFQVISEIEDAFDIQIETEEGLS TVGDLVAYVEEKTK NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atggcagtatttgaaaaagtacaagaaattatcgttgaagaacttggtaaagaaccatca gaagtaacacttgagtctacttttgaagatcttgaagctgattcattggatttgttccaa gtgatttcagaaattgaagatgcattcgacattcaaattgaaactgaagaaggattgtct actgtaggtgaccttgttgcttacgtagaagaaaaaactaaataa

DBGET integrated database retrieval system