Singulisphaera sp. Ch08: V5E97_31405 Help Entry V5E97_31405       CDS       T11449                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism sing  Singulisphaera sp. Ch08 Pathway sing01100   Metabolic pathways sing01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sing00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     V5E97_31405    00074 Mycolic acid biosynthesis     V5E97_31405   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     V5E97_31405 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  XBH02790 UniProt:  A0AAU7CCD6 LinkDB All DBs Position 8398605..8398862 Genome browser AA seq 85 aa AA seqDB search MAELTLLDSVANAIRAEAENTRTLTIEPNTRLVEDLDLDSIDIVGVTMRLEDRFHIEIDM EDIKHFRSVSDLIDQVSILLGKSAA NT seq 258 nt NT seq  +upstreamnt  +downstreamnt gtggccgaacttacacttctagactcggttgccaacgccatccgcgccgaggcagagaat actcgtaccctgacgatcgagccgaacacgcgcctggtcgaggaccttgacctcgactcg atcgacatcgtcggcgtgacgatgcggctcgaagaccgattccacatcgagatcgatatg gaagatatcaaacactttcgctcggtcagtgatctgatcgaccaggtgtcgattcttctc ggcaagtcggctgcttga

DBGET integrated database retrieval system