Saccoglossus kowalevskii (acorn worm): 100526422 Help Entry 100526422         ncRNA     T04123                                  Symbol Mir31 Name (RefSeq) sko-miR-31   KO K17183   microRNA 31 Organism sko  Saccoglossus kowalevskii (acorn worm) Brite KEGG Orthology (KO) [BR:sko00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:sko04147]     100526422 (Mir31)   09184 RNA family    03100 Non-coding RNAs [BR:sko03100]     100526422 (Mir31) Exosome [BR:sko04147]  Exosomal RNA   Exosomal RNA of melanoma cells    100526422 (Mir31) Non-coding RNAs [BR:sko03100]  Other eukaryotic RNA   Micro RNA    100526422 (Mir31) SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  100526422 miRBase:  MI0010152 LinkDB All DBs Position Unknown NT seq 22 nt NT seq  +upstreamnt  +downstreamnt aggcaagatgttggcatagctg

DBGET integrated database retrieval system