Streptomyces laculatispora: P8A22_09035 Help Entry P8A22_09035       CDS       T09657                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism slai  Streptomyces laculatispora Pathway slai00253   Tetracycline biosynthesis slai01056   Biosynthesis of type II polyketide backbone slai01100   Metabolic pathways slai01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:slai00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     P8A22_09035    00253 Tetracycline biosynthesis     P8A22_09035  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:slai01004]     P8A22_09035    01008 Polyketide biosynthesis proteins [BR:slai01008]     P8A22_09035 Lipid biosynthesis proteins [BR:slai01004]  Polyketide synthase   Component type    P8A22_09035 Polyketide biosynthesis proteins [BR:slai01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      P8A22_09035     Nonaketide PKS      P8A22_09035     Decaketide PKS      P8A22_09035 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  WLQ45235 LinkDB All DBs Position complement(2134266..2134535) Genome browser AA seq 89 aa AA seqDB search MSKTECTVEDLKRILLEGAGADEDVDLDADILDTDFESLGYESLALLETAGRIEREFGIT LDDEVFVDNPTPRALVAAVNAQLLGSVAA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgtccaagaccgagtgcaccgtcgaggacctcaagcgcatcctgctggagggtgcgggg gccgacgaggacgtggacctcgacgccgacatcctcgacaccgacttcgagagcctcggc tacgagtcgctggcccttctggagaccgcggggcggatcgagcgggagttcggcatcacc ctcgacgacgaggtcttcgtcgacaaccccaccccgcgtgcgctggtggccgccgtcaat gcgcagctgctcggctccgtcgccgcctga

DBGET integrated database retrieval system