Sulfuricaulis limicola: SCL_2567 Help Entry SCL_2567          CDS       T05241                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism slim  Sulfuricaulis limicola Brite KEGG Orthology (KO) [BR:slim00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:slim03036]     SCL_2567 Chromosome and associated proteins [BR:slim03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     SCL_2567 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB DUF7491 COG6_N TSC22 SKA2 Mod_r Spectrin bZIP_1 FliD_C CCDC138_cc LURAP DivIC Seryl_tRNA_N YabA Herpes_UL6 betaPIX_CC DUF2203 CATRA-C HALZ DUF16 DUF6262 TMPIT FapA DUF4140 Motif Other DBs NCBI-ProteinID:  BAV34844 UniProt:  A0A1B4XJ67 LinkDB All DBs Position 2617695..2617931 Genome browser AA seq 78 aa AA seqDB search MCDMASDDSRLDSTDLKILESRIDELIETCRRLKNENQALKSDQDSLSEQHARLMEKTRH ARARIETMIDRLKALERS NT seq 237 nt NT seq  +upstreamnt  +downstreamnt gtgtgcgacatggcaagcgatgattcccgtctggacagcacggacctcaagattctcgag agccgcatcgacgaactcatcgagacctgccggcgcctgaaaaacgaaaaccaggcgctc aagtcggaccaggacagtctcagcgagcagcacgcgcgcctgatggaaaaaacccgtcac gcccgcgcacgcatcgaaaccatgatcgaccgcctcaaggcgctggagcgcagctga

DBGET integrated database retrieval system