Shewanella loihica: Shew_1304 Help Entry Shew_1304         CDS       T00489                                  Name (GenBank) cyd operon protein YbgT   KO K00424   cytochrome bd-I ubiquinol oxidase subunit X [EC:7.1.1.7] Organism slo  Shewanella loihica Pathway slo00190   Oxidative phosphorylation slo01100   Metabolic pathways slo02020   Two-component system Module slo_M00153   Cytochrome bd ubiquinol oxidase Brite KEGG Orthology (KO) [BR:slo00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     Shew_1304  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     Shew_1304 Enzymes [BR:slo01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.7  quinol oxidase (electrogenic, proton-motive force generating)      Shew_1304 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  YbgT_YccB Motif Other DBs NCBI-ProteinID:  ABO23174 UniProt:  A3QCH6 LinkDB All DBs Position 1512213..1512329 Genome browser AA seq 38 aa AA seqDB search MWYFAWILGILLACSFGIINALWLENTENMDRDSELKD NT seq 117 nt NT seq  +upstreamnt  +downstreamnt atgtggtattttgcttggatattaggcattttgctggcgtgttctttcggtatcatcaac gccttgtggttagagaatactgagaacatggatagggattcagagcttaaagattaa

DBGET integrated database retrieval system