Serratia liquefaciens: M495_24175 Help Entry M495_24175        CDS       T02740                                  Name (GenBank) glutaredoxin   KO K03676   glutaredoxin 3 Organism slq  Serratia liquefaciens Brite KEGG Orthology (KO) [BR:slq00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:slq03110]     M495_24175 Chaperones and folding catalysts [BR:slq03110]  Protein folding catalysts   Protein disulfide isomerase    M495_24175 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_3 GST_N_2 Glrx-like SH3BGR Thioredoxin_3 CLIC-like_N GST_N Motif Other DBs NCBI-ProteinID:  AGQ28866 LinkDB All DBs Position complement(5098554..5098802) Genome browser AA seq 82 aa AA seqDB search MANIDIYTKATCPFCHRAKALLNSKGAAFNEIAIDGDNEKREAMIARSGRTTVPQIFIDG QHIGGCDDLYELDARGGLDPLL NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggctaacattgatatctacaccaaagcgacctgtccgttctgccatcgcgctaaagcg ctgctgaacagcaagggcgccgcgtttaacgaaatcgccatcgatggcgataatgaaaaa cgcgaagcgatgattgcgcgcagtgggcgcaccaccgtgcctcagattttcatcgatggc caacatatcggcggctgcgatgatttatatgaactcgatgctcgtggtggtctggatccg ctgctttaa

DBGET integrated database retrieval system