Sphingopyxis macrogoltabida EY-1: AN936_04440 Help Entry AN936_04440       CDS       T04104                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism smag  Sphingopyxis macrogoltabida EY-1 Pathway smag01100   Metabolic pathways smag01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:smag00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AN936_04440    00074 Mycolic acid biosynthesis     AN936_04440   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AN936_04440 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ALH79640 UniProt:  A0A0N9USP3 LinkDB All DBs Position complement(953709..953975) Genome browser AA seq 88 aa AA seqDB search MTDHINVDATLRALLADVLGLGEERAAALTADGGLFGELPEFDSMAVATVLTEMEDRLGI LIDDDEIDGEIFETYGNLLAFSERKVAG NT seq 267 nt NT seq  +upstreamnt  +downstreamnt gtgaccgatcacatcaatgtcgatgccaccttgcgcgcgctgctcgccgatgttctcggc ctcggcgaagagcgcgccgctgcgctgaccgccgacggcggcctcttcggcgagctgccc gagttcgattcgatggcagtggcgacggtgctcaccgagatggaggaccgcctcggcatc ctcatcgacgatgacgagatcgacggtgaaatctttgaaacctacggcaatctcctcgcc ttctccgaacgcaaggtcgccggctga

DBGET integrated database retrieval system