Serratia marcescens SM39: SM39_4564 Help Entry SM39_4564         CDS       T03592                                  Symbol grxC Name (GenBank) glutaredoxin 3   KO K03676   glutaredoxin 3 Organism smar  Serratia marcescens SM39 Brite KEGG Orthology (KO) [BR:smar00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:smar03110]     SM39_4564 (grxC) Chaperones and folding catalysts [BR:smar03110]  Protein folding catalysts   Protein disulfide isomerase    SM39_4564 (grxC) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_3 GST_N_2 Glrx-like SH3BGR DUF99 Thioredoxin_3 CLIC-like_N GST_N Motif Other DBs NCBI-ProteinID:  BAO36483 UniProt:  A0AAT9F4V8 LinkDB All DBs Position 4760344..4760592 Genome browser AA seq 82 aa AA seqDB search MANIDIYTKATCPFCHRAKALLNSKGAAFNEIAIDGDNAKREVMIERSGRTTVPQIFIDG RHIGGCDDLYELDARGGLDPLL NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggctaacattgatatctacaccaaagcgacctgtccgttctgccatcgcgccaaggcg ctgttgaacagcaagggcgcggcgtttaacgagatcgccatcgacggcgataacgccaag cgcgaagtgatgatcgagcgcagcgggcgcaccaccgtgccgcagattttcatcgatggc cggcatatcggcggctgcgatgatttatatgaactcgatgctcgcggcggcctggatcca ctgctttaa

DBGET integrated database retrieval system