Sphingopyxis macrogoltabida 203: LH19_16545 Help Entry LH19_16545        CDS       T04627                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism smaz  Sphingopyxis macrogoltabida 203 Pathway smaz01100   Metabolic pathways smaz01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:smaz00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LH19_16545    00074 Mycolic acid biosynthesis     LH19_16545   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LH19_16545 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ALJ14481 UniProt:  A0AAC8Z328 LinkDB All DBs Position 3261613..3261879 Genome browser AA seq 88 aa AA seqDB search MTDHINVDATLRALLADVLGLGEERAAALTADSGLFGELPEFDSMAVATVLTEMEDRLGI LIDDDEIDGEIFETYGNLLAFSERKVAG NT seq 267 nt NT seq  +upstreamnt  +downstreamnt gtgaccgatcacatcaatgtcgatgccaccttgcgcgcgctgctcgccgatgttctcggc ctcggcgaagagcgcgccgccgcgctgaccgccgacagcggcctcttcggcgagctgccc gagttcgattcgatggcggtcgcaacggtgctcaccgagatggaggaccgcctcggcatc ctcatcgacgatgacgagatcgacggcgaaatctttgaaacctacggcaatctcctcgcc ttctccgaacgcaaggtcgccggctga

DBGET integrated database retrieval system