Sinorhizobium meliloti 2011: SM2011_b22009 Help Entry SM2011_b22009     CDS       T02497                                  Name (GenBank) Acyl carrier protein (ACP)   KO K02078   acyl carrier protein Organism smel  Sinorhizobium meliloti 2011 Pathway smel01100   Metabolic pathways smel01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:smel00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SM2011_b22009    00074 Mycolic acid biosynthesis     SM2011_b22009   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SM2011_b22009 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L12_N WGG Motif Other DBs NCBI-ProteinID:  AGG71642 LinkDB All DBs Position pSymB:complement(677566..677841) Genome browser AA seq 91 aa AA seqDB search MCSRSKGHRMENSKAATRVRAIIIEQLGVDPARATDDASIVDDLGADSLEVAQIVMMIED EFNIEISDESADAVVTVGDAIYVVVASKTKS NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgtgctctcgctccaagggacaccggatggaaaactccaaggctgcaacccgtgtaagg gcaatcatcatcgagcagttgggtgtcgaccctgcccgcgctacggacgacgcgtccata gtcgacgacctcggcgccgattctctcgaagtggcgcaaattgtcatgatgatcgaggac gagttcaatatcgaaatttcagacgagtcggctgacgccgttgtcacggttggagatgcc atctacgtcgtcgtcgcgtcaaaaactaagagctaa

DBGET integrated database retrieval system