Silurus meridionalis (southern catfish): 10079905 Help Entry 10079905          CDS       T08004                                  Symbol ND4L Name (RefSeq) NADH dehydrogenase subunit 4L   KO K03882   NADH-ubiquinone oxidoreductase chain 4L [EC:7.1.1.2] Organism smeo  Silurus meridionalis (southern catfish) Pathway smeo00190   Oxidative phosphorylation smeo01100   Metabolic pathways Module smeo_M00142   NADH:ubiquinone oxidoreductase, mitochondria Brite KEGG Orthology (KO) [BR:smeo00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     10079905 (ND4L)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03029 Mitochondrial biogenesis [BR:smeo03029]     10079905 (ND4L) Enzymes [BR:smeo01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.2  NADH:ubiquinone reductase (H+-translocating)      10079905 (ND4L) Mitochondrial biogenesis [BR:smeo03029]  Mitochondrial DNA transcription, translation, and replication factors   Mitochondrial DNA-encoded proteins    Mitochondrial respiratory chain complex I     10079905 (ND4L) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Oxidored_q2 Motif Other DBs NCBI-GeneID:  10079905 NCBI-ProteinID:  YP_004123345 UniProt:  E7CV83 LinkDB All DBs Position MT:10065..10361 Genome browser AA seq 98 aa AA seqDB search MTPVYFSFTSAFTLGLLGLAFHRTHLLSALLCLEGMMLSLFIALALWMLQLESTAFSAAP ILLLAFSACEASAGLALLVATARTHGTDRLQALSLLQC NT seq 297 nt NT seq  +upstreamnt  +downstreamnt atgacacctgtatacttcagctttacatcagcatttaccttgggactcttgggcctagcc ttccaccgcacccacctcctatctgcactcctttgtctggagggaataatattatcccta tttattgcattagccttatgaatgctgcaactagaatccactgctttctccgcagccccc atcctcctactagccttttcagcctgcgaagccagtgcaggcctggccctactagttgcc accgcccggacccacggaactgatcgattacaagccctaagcctcctacaatgctaa

DBGET integrated database retrieval system