Sinorhizobium meliloti Rm41: BN406_05985 Help Entry BN406_05985       CDS       T02332                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism smi  Sinorhizobium meliloti Rm41 Pathway smi01100   Metabolic pathways smi01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:smi00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BN406_05985    00074 Mycolic acid biosynthesis     BN406_05985   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BN406_05985 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C Ribosomal_L12_N WGG Motif Other DBs NCBI-ProteinID:  CCM72267 LinkDB All DBs Position pSYMB:993625..993873 Genome browser AA seq 82 aa AA seqDB search MESSNVANRVRAIIIEQLGVDPARATDDASIVDDLGADSLEVAQIVMMIEDEFNIEISDE SADAVVTVGDAIYVVVASKTKS NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggaaagctccaacgttgcaaaccgtgtcagggcaatcatcatcgagcagttgggtgtc gaccctgcccgcgctacggacgacgcgtccattgtcgacgacctcggtgccgattctctc gaagtggcgcaaattgtcatgatgatcgaggacgagttcaatatcgaaatttcagatgag tcggctgacgccgttgttacggttggagatgccatctacgtcgtcgtcgcgtcaaagact aagagctaa

DBGET integrated database retrieval system