Streptomyces moderatus: POD33_14220 Help Entry POD33_14220       CDS       T10886                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism smod  Streptomyces moderatus Pathway smod00998   Biosynthesis of various antibiotics smod01100   Metabolic pathways smod01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:smod00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     POD33_14220    00074 Mycolic acid biosynthesis     POD33_14220   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     POD33_14220 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  WCH93209 LinkDB All DBs Position 3114348..3114629 Genome browser AA seq 93 aa AA seqDB search MTENTAVVDTAERARFVDAVRKGLSEVLNKDVSGADEGVRLFDELGLDSSSALELLITIE EILDVQFDAEDLEMTHFETVGSLADFVAAEAGA NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atgaccgagaacaccgcagtcgtggacaccgccgagcgcgcgcgcttcgtggacgccgtc cgcaagggcctgagcgaggtcctgaacaaggacgtctccggcgccgacgagggcgtgcgc ctcttcgacgagctcgggctcgactccagcagcgcgctggagctgctcatcaccatcgag gagatcctcgacgtgcagttcgacgccgaggacctggagatgacgcacttcgagacggtg ggctcgctcgccgacttcgtcgcggcggaagcgggcgcctga

DBGET integrated database retrieval system