Salvelinus namaycush (lake trout): 120053902 Help Entry 120053902         CDS       T07522                                  Symbol mt2 Name (RefSeq) metallothionein-2   KO K14739   metallothionein 1/2 Organism snh  Salvelinus namaycush (lake trout) Brite KEGG Orthology (KO) [BR:snh00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:snh03019]     120053902 (mt2)    03029 Mitochondrial biogenesis [BR:snh03029]     120053902 (mt2) Messenger RNA biogenesis [BR:snh03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      120053902 (mt2) Mitochondrial biogenesis [BR:snh03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     120053902 (mt2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  120053902 NCBI-ProteinID:  XP_038857126 UniProt:  A0A8U1BMU0 LinkDB All DBs Position Sna9:complement(26349250..26349955) Genome browser AA seq 61 aa AA seqDB search MDPCECSKTGSCNCGGSCKCSNCACTSCKKASCCDCCPSGCSKCASGCVCKGKTCDTSCC Q NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggatccttgtgaatgctccaaaactggatcttgcaactgcggtggatcctgcaagtgc tccaactgcgcatgcaccagttgtaagaaagcaagttgctgcgactgctgtccctccggc tgcagcaagtgtgcctcaggctgcgtgtgcaagggcaagacttgtgataccagctgttgt cagtaa

DBGET integrated database retrieval system