Streptomyces nodosus: CP978_29150 Help Entry CP978_29150       CDS       T06839                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism snq  Streptomyces nodosus Pathway snq00998   Biosynthesis of various antibiotics snq01100   Metabolic pathways snq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:snq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CP978_29150    00074 Mycolic acid biosynthesis     CP978_29150   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CP978_29150 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  QEV42094 UniProt:  A0A0B5DK84 LinkDB All DBs Position complement(6585672..6585923) Genome browser AA seq 83 aa AA seqDB search MTTSAENKTAKIKEIICDILELEEDEVTETSLFKEDHGADSLRAIEILAALEKNFHVVID QAELGRMVNLKGVEEVVAEAAGK NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgacgacctctgctgagaacaagaccgcgaaaatcaaggaaatcatctgcgacatcctc gagctcgaggaggacgaggtcaccgagaccagcctcttcaaggaggaccacggcgccgac tcgctgcgtgcgatcgagatcctcgccgccctggagaagaacttccacgtcgtcatcgac caggccgagctgggccgcatggtcaacctcaagggcgtcgaagaggtcgtggcagaggcc gccggcaagtag

DBGET integrated database retrieval system