Streptomyces niveus: BBN63_01875 Help Entry BBN63_01875       CDS       T04887                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism snw  Streptomyces niveus Pathway snw00998   Biosynthesis of various antibiotics snw01100   Metabolic pathways snw01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:snw00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BBN63_01875    00074 Mycolic acid biosynthesis     BBN63_01875   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BBN63_01875 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding cwf21 Motif Other DBs NCBI-ProteinID:  AQU65190 UniProt:  A0A1U9QLY4 LinkDB All DBs Position 472311..472622 Genome browser AA seq 103 aa AA seqDB search MTTETIAGTAAAVQSDITAMLRTMLEEDGLDDAEITRETTFHDDLELESIDLVTLAGSLR EHYGDRVNLALFIADLDLEEIIALTVGELIDYVAASLHADGQV NT seq 312 nt NT seq  +upstreamnt  +downstreamnt atgaccaccgaaacgatcgcgggtacggcggcggccgtgcagagcgacatcaccgcgatg ctgcggaccatgctggaggaggacggcctcgacgacgcggagatcacgcgcgagaccacc ttccacgacgatctcgaactggagagcatcgatctggtgaccctggcgggttcgctccgc gagcactacggcgaccgggtcaacctggccctgttcatcgccgacctggacctggaggag atcatcgcgctgacggtcggcgagctgatcgactacgtcgccgcctccttgcacgcggac gggcaggtctga

DBGET integrated database retrieval system