Stenotrophomonas oahuensis: PDM29_10750 Help Entry PDM29_10750       CDS       T10110                                  Symbol ftsL Name (GenBank) cell division protein FtsL   KO K03586   cell division protein FtsL Organism sou  Stenotrophomonas oahuensis Brite KEGG Orthology (KO) [BR:sou00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:sou03036]     PDM29_10750 (ftsL) Chromosome and associated proteins [BR:sou03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     PDM29_10750 (ftsL) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FtsL DivIC DUF3433 Motif Other DBs NCBI-ProteinID:  WNH50870 UniProt:  A0ABY9YK80 LinkDB All DBs Position 2454336..2454599 Genome browser AA seq 87 aa AA seqDB search MSRLLLVILLAATIASAIGVVFMRHRHRQTFVELSRAERARDELNIEFGRLQLEQATLAE ATRVDRVARERLGMKFPEANDVVVVRP NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgagccgccttctgctggtgattttgctggccgccaccatcgcctcggcgatcggtgtc gtgttcatgcgccaccgtcaccggcagaccttcgtcgagctttcgcgcgccgagcgcgcc cgcgacgaactgaacatcgaattcggccgcctgcagctggaacaggccaccctggccgaa gccacccgcgtcgaccgggtggcacgtgagcgcctgggcatgaagttcccggaagccaat gatgtcgtggtggtgcgcccatga

DBGET integrated database retrieval system