Sphingomonas panacis: AWL63_13740 Help Entry AWL63_13740       CDS       T04760                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism span  Sphingomonas panacis Pathway span01100   Metabolic pathways span01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:span00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AWL63_13740    00074 Mycolic acid biosynthesis     AWL63_13740   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AWL63_13740 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 DUF1493 DUF5783 Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  AOH86782 UniProt:  A0A1B3ZH82 LinkDB All DBs Position 3033049..3033285 Genome browser AA seq 78 aa AA seqDB search MSETADRVKKIVVEHLGVEADKVTEDASFIDDLGADSLDIVELVMAFEEEFEVEIPDDAA EKIATVKDAITFIDEHKG NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atgagcgagactgccgatcgcgtaaagaagatcgtcgtcgagcacctcggcgtcgaagcc gacaaggtgacggaggatgcgagcttcatcgatgatctgggcgccgacagcctcgatatc gttgagctcgtgatggcgttcgaagaggagttcgaagtcgaaatccccgacgacgccgct gagaagatcgcgaccgtgaaggatgcgatcaccttcatcgacgagcacaagggctga

DBGET integrated database retrieval system