Sphingopyxis fribergensis: SKP52_03545 Help Entry SKP52_03545       CDS       T03542                                  Name (GenBank) hypothetical protein   KO K03602   exodeoxyribonuclease VII small subunit [EC:3.1.11.6] Organism sphk  Sphingopyxis fribergensis Pathway sphk03430   Mismatch repair Brite KEGG Orthology (KO) [BR:sphk00001]  09120 Genetic Information Processing   09124 Replication and repair    03430 Mismatch repair     SKP52_03545  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:sphk03400]     SKP52_03545 Enzymes [BR:sphk01000]  3. Hydrolases   3.1  Acting on ester bonds    3.1.11  Exodeoxyribonucleases producing 5'-phosphomonoesters     3.1.11.6  exodeoxyribonuclease VII      SKP52_03545 DNA repair and recombination proteins [BR:sphk03400]  Prokaryotic type   SSBR (single strand breaks repair)    MMR (mismatch excision repair)     DNA exonucleases      SKP52_03545 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Exonuc_VII_S Phage_TAC_11 Motif Other DBs NCBI-ProteinID:  AJA07638 UniProt:  A0A0A7PEL8 LinkDB All DBs Position 714793..715056 Genome browser AA seq 87 aa AA seqDB search MTDTPETAAAPALASLSFEAAMGELETIVRRLESGDVSLEESVALYERGHALRGHCEARL AAAQARIEQVSLGADGRPAGTTPFGES NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgacggatacccccgaaaccgctgccgcccccgctcttgcgtccctgtcgttcgaggct gcgatgggcgagctcgaaacgatcgtgcggcggctggagagcggcgacgtcagcctcgag gaatcggtggcgctttacgagcgcggccacgcgctgcgcggccattgcgaggctcggctc gccgcggcgcaggcgcggatcgaacaggtcagcctgggcgccgacggccggccggcggga accacccccttcggtgaaagctga

DBGET integrated database retrieval system