Uncultured Sphingopyxis sp. UC10: SPPYR_0517 Help Entry SPPYR_0517        CDS       T05531                                  Symbol xseB Name (GenBank) exonuclease VII small subunit   KO K03602   exodeoxyribonuclease VII small subunit [EC:3.1.11.6] Organism sphu  Uncultured Sphingopyxis sp. UC10 Pathway sphu03430   Mismatch repair Brite KEGG Orthology (KO) [BR:sphu00001]  09120 Genetic Information Processing   09124 Replication and repair    03430 Mismatch repair     SPPYR_0517 (xseB)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:sphu03400]     SPPYR_0517 (xseB) Enzymes [BR:sphu01000]  3. Hydrolases   3.1  Acting on ester bonds    3.1.11  Exodeoxyribonucleases producing 5'-phosphomonoesters     3.1.11.6  exodeoxyribonuclease VII      SPPYR_0517 (xseB) DNA repair and recombination proteins [BR:sphu03400]  Prokaryotic type   SSBR (single strand breaks repair)    MMR (mismatch excision repair)     DNA exonucleases      SPPYR_0517 (xseB) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Exonuc_VII_S Phage_TAC_11 Motif Other DBs NCBI-ProteinID:  SBV31637 UniProt:  A0A1Y5PVW5 LinkDB All DBs Position SPPYR:554538..554801 Genome browser AA seq 87 aa AA seqDB search MTDTPDPAAAADIASLSFEAAMGELETIVRRLESGDVSLEESVTLYERGHALRGHCEARL AAAQARIEQVSLGADGRPAGTTSFGES NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgacggatacccccgaccccgctgccgccgcggacatcgcctcgctgtcgttcgaagcc gcgatgggcgagctcgaaacgatcgtgcggcggctcgaaagcggcgacgtcagcctcgag gaatcggtgacgctttacgagcgcggccatgcgctccgcggtcattgcgaagcgcggctg gcggcggcgcaggcgcggatcgagcaggtcagcctgggcgccgacggccggcccgcggga accacgtccttcggcgaaagctga

DBGET integrated database retrieval system