Sulfuriferula plumbiphila: SFPGR_16740 Help Entry SFPGR_16740       CDS       T06621                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism splb  Sulfuriferula plumbiphila Pathway splb01100   Metabolic pathways splb01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:splb00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SFPGR_16740    00074 Mycolic acid biosynthesis     SFPGR_16740   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SFPGR_16740 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 DUF6699 Motif Other DBs NCBI-ProteinID:  BBP04252 LinkDB All DBs Position complement(1622932..1623168) Genome browser AA seq 78 aa AA seqDB search MNDTENRLCDMLAQQLEIPRAGLSRETTLEQIGLDSLATIEFMFQIEDSFNIRFDQTGEP PVTVGDVLDQVTAKLQHE NT seq 237 nt NT seq  +upstreamnt  +downstreamnt gtgaacgataccgaaaaccgcctgtgcgacatgctggctcagcaacttgagattccccgc gcggggctttcgcgcgaaacgacactggaacaaatcgggctcgactcgctggccaccatc gaattcatgttccagatcgaggacagtttcaatattcgttttgaccaaaccggcgagccg ccggtaaccgtcggtgatgtgctggatcaggtcaccgcaaagctccagcatgagtga

DBGET integrated database retrieval system