Sporosarcina sp. ANT_H38: GGGNBK_07670 Help Entry GGGNBK_07670      CDS       T10925                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism spoh  Sporosarcina sp. ANT_H38 Pathway spoh01100   Metabolic pathways spoh01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:spoh00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     GGGNBK_07670 (acpP)    00074 Mycolic acid biosynthesis     GGGNBK_07670 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     GGGNBK_07670 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Motif Other DBs NCBI-ProteinID:  XKI11507 LinkDB All DBs Position 1594114..1594350 Genome browser AA seq 78 aa AA seqDB search MSTVLERVTKVIVDRLGVDESEVKMEASFRDDLGADSLDVVELVMELEDEFEMEISDDEA EKIATVGDAVSHIETKVK NT seq 237 nt NT seq  +upstreamnt  +downstreamnt ttgtcaacagtacttgaacgtgtaactaaagtaattgtcgaccgccttggcgtcgatgaa agtgaagttaaaatggaagcttctttccgtgacgatctcggcgcagattcattggacgtc gtagaattagtaatggaattagaagatgaattcgaaatggaaatttccgatgatgaagct gaaaagattgcaactgtcggtgacgcagtttcgcatatcgaaacgaaagtaaaataa

DBGET integrated database retrieval system