Sphingobium phenoxybenzoativorans: KFK14_19450 Help Entry KFK14_19450       CDS       T07582                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism spph  Sphingobium phenoxybenzoativorans Brite KEGG Orthology (KO) [BR:spph00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:spph03032]     KFK14_19450    03036 Chromosome and associated proteins [BR:spph03036]     KFK14_19450    03400 DNA repair and recombination proteins [BR:spph03400]     KFK14_19450 DNA replication proteins [BR:spph03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     KFK14_19450 Chromosome and associated proteins [BR:spph03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     KFK14_19450 DNA repair and recombination proteins [BR:spph03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       KFK14_19450 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Phage_cement_2 HU-CCDC81_bac_2 Motif Other DBs NCBI-ProteinID:  QUT05152 UniProt:  A0A975K803 LinkDB All DBs Position complement(3934686..3934961) Genome browser AA seq 91 aa AA seqDB search MNQAELVDALAADQGIAKSDAKKFLDAAFGVIASTAAKGEEISINGFGKFKVKDSPARDG RNPATGETISIAASRKLAFSPAKALKDKLNG NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgaaccaggctgaacttgttgatgctcttgcggctgaccagggtatcgcgaaaagcgat gccaagaaatttctcgatgctgcattcggcgtgattgcgtccaccgccgctaagggtgag gaaatctcgatcaacggctttggcaagttcaaggtcaaggacagccccgcccgtgacggc cgcaatccggccacgggcgagacgatcagcattgcagcctcgcgcaagctggccttctct cccgcaaaggctcttaaggataagctgaacggttga

DBGET integrated database retrieval system