Streptomyces fodineus: BFF78_17095 Help Entry BFF78_17095       CDS       T05140                                  Name (GenBank) chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism spun  Streptomyces fodineus Pathway spun00400   Phenylalanine, tyrosine and tryptophan biosynthesis spun01100   Metabolic pathways spun01110   Biosynthesis of secondary metabolites spun01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:spun00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     BFF78_17095 Enzymes [BR:spun01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      BFF78_17095 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Motif Other DBs NCBI-ProteinID:  AOR32550 UniProt:  A0A1D7YAQ0 LinkDB All DBs Position 4142074..4142331 Genome browser AA seq 85 aa AA seqDB search MTTTTPEETIAGARDRIDVLDDRIIGLIQERMAVSAVVQQTRIASGGRRVHLSREMEILG RYREALGKPGTGLAMTLLELCRGRV NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgaccaccaccaccccggaagagaccatcgccggcgcccgtgaccggatcgatgtgctc gacgaccggatcatcggtctcatccaggagcggatggccgtctccgccgtcgtccagcag acccgtatcgcctccggcgggcggcgcgtgcacctctcgcgtgagatggagatcctcggc cgctaccgcgaggccctcggcaagccgggcaccggcctcgccatgaccctgctcgagctg tgccgggggcgtgtctga

DBGET integrated database retrieval system