Sphingobium sp. YG1: YGS_C2P0500 Help Entry YGS_C2P0500       CDS       T05858                                  Name (GenBank) DNA-binding protein HU-beta   KO K03530   DNA-binding protein HU-beta Organism spyg  Sphingobium sp. YG1 Brite KEGG Orthology (KO) [BR:spyg00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:spyg03032]     YGS_C2P0500    03036 Chromosome and associated proteins [BR:spyg03036]     YGS_C2P0500    03400 DNA repair and recombination proteins [BR:spyg03400]     YGS_C2P0500 DNA replication proteins [BR:spyg03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     YGS_C2P0500 Chromosome and associated proteins [BR:spyg03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     YGS_C2P0500 DNA repair and recombination proteins [BR:spyg03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       YGS_C2P0500 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Phage_cement_2 DUF4287 Motif Other DBs NCBI-ProteinID:  BBD02486 UniProt:  A0A2Z6AKE9 LinkDB All DBs Position 2:complement(660142..660417) Genome browser AA seq 91 aa AA seqDB search MNNSELAEALSADHGLTKGDARKLVDALFGVIADAAAKGDEISLNGFGKFKVKDVAAREG RNPATGETIAIKASKKLTFTPAKAIKDRLNG NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgaacaattccgagctggctgaagcgctcagcgccgatcatggactgaccaagggtgac gcacgcaaactcgtcgacgccctgtttggggtcatcgccgacgcggcggccaaaggcgac gagatttcgctgaacggcttcggcaagttcaaggtgaaggacgttgcagcgcgcgagggc cgcaatccggccaccggcgaaaccatcgccatcaaggcgtcgaagaagctgacgttcacg cccgcaaaggcgatcaaggaccgtctcaacggctga

DBGET integrated database retrieval system