Streptomyces rectiverticillatus: FGW37_04265 Help Entry FGW37_04265       CDS       T06927                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism srk  Streptomyces rectiverticillatus Pathway srk00253   Tetracycline biosynthesis srk01056   Biosynthesis of type II polyketide backbone srk01100   Metabolic pathways srk01110   Biosynthesis of secondary metabolites Module srk_M00778   Type II polyketide backbone biosynthesis, acyl-CoA + malonyl-CoA => polyketide Brite KEGG Orthology (KO) [BR:srk00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     FGW37_04265    00253 Tetracycline biosynthesis     FGW37_04265  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:srk01004]     FGW37_04265    01008 Polyketide biosynthesis proteins [BR:srk01008]     FGW37_04265 Lipid biosynthesis proteins [BR:srk01004]  Polyketide synthase   Component type    FGW37_04265 Polyketide biosynthesis proteins [BR:srk01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      FGW37_04265     Nonaketide PKS      FGW37_04265     Decaketide PKS      FGW37_04265 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  QLE70924 LinkDB All DBs Position 1043395..1043664 Genome browser AA seq 89 aa AA seqDB search MPAREFTLEELKATLLEGAGTDENVDLDGDIVDSSFDDLGYESLAMLETVGRIERELGIS LGEDVLAEARTPRALLRLVNDCLSAAHTA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgcctgccagggaattcaccctcgaagagctcaaggccacgctgctggaaggcgcgggc accgacgagaacgtcgatctcgacggcgacatcgtcgactcttccttcgacgacctcggc tacgagtcgctcgcgatgctggagaccgtcggccgcatcgagcgggagctcgggatcagc ctgggcgaggacgtgctggccgaggcacgcaccccgcgtgcgctgctccggctcgtcaac gactgcctgtccgccgcgcacaccgcctga

DBGET integrated database retrieval system