Serratia plymuthica S13: M621_25090 Help Entry M621_25090        CDS       T02716                                  Name (GenBank) glutaredoxin   KO K03676   glutaredoxin 3 Organism sry  Serratia plymuthica S13 Brite KEGG Orthology (KO) [BR:sry00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:sry03110]     M621_25090 Chaperones and folding catalysts [BR:sry03110]  Protein folding catalysts   Protein disulfide isomerase    M621_25090 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_3 GST_N_2 Glrx-like SH3BGR Thioredoxin_3 CLIC-like_N GST_N Thioredoxin_2 Motif Other DBs NCBI-ProteinID:  AGP46587 UniProt:  S4YMS6 LinkDB All DBs Position complement(5343155..5343403) Genome browser AA seq 82 aa AA seqDB search MANIDIYTKATCPFCHRAKALLNSKGAAFNEIAIDGDNEKREAMIARSGRTTVPQIFIDD RHIGGCDDLYELDARGGLDPLL NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggctaacattgatatctacaccaaagcgacctgtccgttctgccatcgcgccaaagcg ctgctgaacagtaagggcgcggcgtttaacgaaatcgccattgatggcgataatgaaaaa cgcgaagcgatgattgcgcgcagtgggcgcaccaccgtgcctcagattttcatcgacgac cggcatatcggcggctgcgatgatttatatgaactcgatgctcgtggtggtctggatccg ttgctataa

DBGET integrated database retrieval system