Spiribacter salinus: SPISAL_08165 Help Entry SPISAL_08165      CDS       T02685                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism ssal  Spiribacter salinus Brite KEGG Orthology (KO) [BR:ssal00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:ssal03036]     SPISAL_08165 Chromosome and associated proteins [BR:ssal03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     SPISAL_08165 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  NET2A ZapB HGD-D CDK5RAP3 bZIP_1 bZIP_2 Syntaxin YabA DUF7605 Motif Other DBs NCBI-ProteinID:  AGM41727 UniProt:  R4VMU6 LinkDB All DBs Position 1682288..1682503 Genome browser AA seq 71 aa AA seqDB search MVDSVTEQVIQLEQRVDRLMRLCDQLRDENRVLLNAQESLNAERAALLDKNETARARLEA MISRLKALEQS NT seq 216 nt NT seq  +upstreamnt  +downstreamnt gtggttgattcggttactgaacaggtcattcagctcgagcagcgggtcgatcggctcatg cggctgtgcgatcagttgcgcgatgaaaaccgggtattgcttaacgcccaggaatcactg aatgccgagcgggccgcgctactcgataagaacgagaccgcgcgggcgcggctagaggca atgatcagccgtctgaaagccctggagcagagctga

DBGET integrated database retrieval system