Sus scrofa (pig): 100316554 Help Entry 100316554         miRNA     T01009                                  Symbol MIR29B-1 Name (RefSeq) ssc-miR-29b   KO K16995   microRNA 29 Organism ssc  Sus scrofa (pig) Pathway ssc05206   MicroRNAs in cancer ssc05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:ssc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100316554 (MIR29B-1)    05207 Chemical carcinogenesis - receptor activation     100316554 (MIR29B-1)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ssc04147]     100316554 (MIR29B-1)   09184 RNA family    03100 Non-coding RNAs [BR:ssc03100]     100316554 (MIR29B-1) Exosome [BR:ssc04147]  Exosomal RNA   Exosomal RNA of breast milk    100316554 (MIR29B-1)   Exosomal RNA of saliva    100316554 (MIR29B-1)   Exosomal RNA of hepatic cancer cells    100316554 (MIR29B-1)   Exosomal RNA of renal carcinoma cells    100316554 (MIR29B-1)   Exosomal RNA of lung cancer cells    100316554 (MIR29B-1) Non-coding RNAs [BR:ssc03100]  Other eukaryotic RNA   Micro RNA    100316554 (MIR29B-1) SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  100316554 Ensembl:  ENSSSCG00000018108 miRBase:  MI0002431 LinkDB All DBs Position 18:18039679..18039701 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt tagcaccatttgaaatcagtgtt

DBGET integrated database retrieval system