Sus scrofa (pig): 100739663 Help Entry 100739663         CDS       T01009                                  Name (RefSeq) metallothionein-1C   KO K14739   metallothionein 1/2 Organism ssc  Sus scrofa (pig) Pathway ssc04978   Mineral absorption Brite KEGG Orthology (KO) [BR:ssc00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     100739663  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:ssc03019]     100739663    03029 Mitochondrial biogenesis [BR:ssc03029]     100739663 Messenger RNA biogenesis [BR:ssc03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      100739663 Mitochondrial biogenesis [BR:ssc03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     100739663 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  100739663 NCBI-ProteinID:  XP_013843991 LinkDB All DBs Position 6:18655972..18657515 Genome browser AA seq 61 aa AA seqDB search MDPNCSCSPGGSCSCAGSCTCKACRCTSCKKSCCSCCPAGCARCAQGCICKGASDNCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgctcctgctcccctggcggctcctgcagctgcgcaggctcctgcacg tgcaaagcctgcagatgcacctcctgcaagaagagctgctgctcctgctgccccgcgggc tgtgccaggtgtgcccagggctgcatctgcaaaggggcctcggacaactgcagctgctgt gcctga

DBGET integrated database retrieval system