Sus scrofa (pig): 104794428 Help Entry 104794428         miRNA     T01009                                  Symbol MIR29B-2 Name (RefSeq) ssc-miR-29b   KO K16995   microRNA 29 Organism ssc  Sus scrofa (pig) Pathway ssc05206   MicroRNAs in cancer ssc05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:ssc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104794428 (MIR29B-2)    05207 Chemical carcinogenesis - receptor activation     104794428 (MIR29B-2)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ssc04147]     104794428 (MIR29B-2)   09184 RNA family    03100 Non-coding RNAs [BR:ssc03100]     104794428 (MIR29B-2) Exosome [BR:ssc04147]  Exosomal RNA   Exosomal RNA of breast milk    104794428 (MIR29B-2)   Exosomal RNA of saliva    104794428 (MIR29B-2)   Exosomal RNA of hepatic cancer cells    104794428 (MIR29B-2)   Exosomal RNA of renal carcinoma cells    104794428 (MIR29B-2)   Exosomal RNA of lung cancer cells    104794428 (MIR29B-2) Non-coding RNAs [BR:ssc03100]  Other eukaryotic RNA   Micro RNA    104794428 (MIR29B-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  104794428 Ensembl:  ENSSSCG00000019034 miRBase:  MI0022126 LinkDB All DBs Position 9:135019079..135019162 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt tagcaccatttgaaatcagtgtt

DBGET integrated database retrieval system