Solea solea (common sole): 131463160 Help Entry 131463160         CDS       T10853                                  Symbol dynll2a Name (RefSeq) dynein, light chain, LC8-type 2a   KO K10418   dynein light chain LC8-type Organism ssoe  Solea solea (common sole) Pathway ssoe04814   Motor proteins ssoe05132   Salmonella infection Brite Cilium and associated proteins [BR:ssoe03037]  Motile cilia and associated proteins   Dynein arm    131463160 (dynll2a) Cytoskeleton proteins [BR:ssoe04812]  Eukaryotic cytoskeleton proteins   Microtubules    Tubulin-binding proteins     Dyneins      131463160 (dynll2a) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  131463160 NCBI-ProteinID:  XP_058490868 LinkDB All DBs Position 7:29360918..29366432 Genome browser AA seq 89 aa AA seqDB search MTDRKAVIKNADMSEDMQQDAVDCATQAMEKYNIEKDIAAYIKKEFDKKYNPTWHCIVGR NFGSYVTHETKHFIYFYLGQVAILLFKSG NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgacggacaggaaagccgtgatcaagaacgcagacatgtctgaggacatgcagcaggac gccgtggactgtgccacacaggccatggagaaatacaacatcgagaaggacatcgcagcg tacatcaagaaggagtttgataagaagtataatcccacctggcactgcatcgtgggcagg aactttggcagctacgtcactcatgagaccaagcactttatttacttctacctgggtcag gtggccatcctgctcttcaagtctggctga

DBGET integrated database retrieval system