Solea solea (common sole): 131470152 Help Entry 131470152         CDS       T10853                                  Symbol mt2 Name (RefSeq) metallothionein-2   KO K14739   metallothionein 1/2 Organism ssoe  Solea solea (common sole) Brite Messenger RNA biogenesis [BR:ssoe03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      131470152 (mt2) Mitochondrial biogenesis [BR:ssoe03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     131470152 (mt2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  131470152 NCBI-ProteinID:  XP_058501753 LinkDB All DBs Position 12:23541758..23542735 Genome browser AA seq 61 aa AA seqDB search MDPCECSKTGNCNCGANCTCTNCTCTTCKKSCCSCCPSGCSKCASGCVCKGKTCDKTCCQ E NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggacccctgcgaatgctccaagactggaaactgcaactgcggagcaaactgcacttgc accaactgcacctgcactacctgcaagaagagctgctgctcatgctgcccatctggctgc agtaagtgcgcctctggctgcgtctgcaaagggaagacatgcgacaagacctgctgtcag gagtga

DBGET integrated database retrieval system