Streptomyces stoeckheimensis: ACE1OC_42515 Help Entry ACE1OC_42515      CDS       T11171                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism ssto  Streptomyces stoeckheimensis Pathway ssto00253   Tetracycline biosynthesis ssto01056   Biosynthesis of type II polyketide backbone ssto01100   Metabolic pathways ssto01110   Biosynthesis of secondary metabolites Module ssto_M00778   Type II polyketide backbone biosynthesis, acyl-CoA + malonyl-CoA => polyketide Brite KEGG Orthology (KO) [BR:ssto00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     ACE1OC_42515    00253 Tetracycline biosynthesis     ACE1OC_42515  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:ssto01004]     ACE1OC_42515    01008 Polyketide biosynthesis proteins [BR:ssto01008]     ACE1OC_42515 Lipid biosynthesis proteins [BR:ssto01004]  Polyketide synthase   Component type    ACE1OC_42515 Polyketide biosynthesis proteins [BR:ssto01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      ACE1OC_42515     Nonaketide PKS      ACE1OC_42515     Decaketide PKS      ACE1OC_42515 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  XLF75790 LinkDB All DBs Position p2:191214..191489 Genome browser AA seq 91 aa AA seqDB search MSDLEFTLDDLRRILLEGAGADEGVDLGADILDVQFEALGYESLALLETGSRIEREYGID LDEDALTNADTPRALIAAVNQHLSVGQRSAA NT seq 276 nt NT seq  +upstreamnt  +downstreamnt gtgtccgatctggaattcaccctggacgacctgcgccgcatcctgctggagggcgccggc gccgatgaaggcgtcgacctcggagccgacatcctcgacgtgcagttcgaggcgctcggc tacgagtccctggccctgctggagaccggcagccgcatcgagcgcgagtacggcatcgac ctcgacgaggacgcgctgaccaacgccgacaccccgcgcgccctcatcgcggccgtcaac cagcacctgagcgtcggccagcgctccgcggcctga

DBGET integrated database retrieval system