Streptococcus pseudopneumoniae: SPPN_02655 Help Entry SPPN_02655        CDS       T01590                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism std  Streptococcus pseudopneumoniae Pathway std01100   Metabolic pathways std01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:std00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SPPN_02655 (acpP)    00074 Mycolic acid biosynthesis     SPPN_02655 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SPPN_02655 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AEL09973 LinkDB All DBs Position 472920..473144 Genome browser AA seq 74 aa AA seqDB search MAVFEKVQEIIVEELGKDASEVTLESTFDDLDADSLDLFQVISEIEDAFDIQIEAEDDLK TVGDLVAYVEEQTK NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atggcagtatttgaaaaagtacaagaaattatcgttgaagaacttggaaaagatgcatca gaagtaacacttgaatcaacttttgatgatttggacgctgattcattggacttgttccaa gtaatctcagaaatcgaagatgcttttgatatccaaatcgaagcagaagatgacttgaaa acagttggtgacttggttgcctacgttgaagagcaaacaaaataa

DBGET integrated database retrieval system