Sporolactobacillus terrae: C0679_06590 Help Entry C0679_06590       CDS       T05792                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism stea  Sporolactobacillus terrae Pathway stea01100   Metabolic pathways stea01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:stea00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     C0679_06590 (acpP)    00074 Mycolic acid biosynthesis     C0679_06590 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     C0679_06590 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Guanylate_cyc DUF1493 DUF1002 Motif Other DBs NCBI-ProteinID:  QAA25291 LinkDB All DBs Position 1377404..1377646 Genome browser AA seq 80 aa AA seqDB search MAAEDVLTRVKKIVVDRLGVDEADVKTEASFKEDLDADSLDIVELVMELEDEFNLEISDE DAEKIQTVGDVVSYIENHKS NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atggcagcagaagatgttttgacacgtgtcaagaagatcgttgttgatcgattgggcgta gacgaagcagacgtgaagactgaagcttcatttaaagaagatctcgacgcagattcactt gacattgtagaacttgtcatggaacttgaagatgaatttaatttggaaatctccgatgaa gatgcggaaaagattcaaaccgtcggtgacgtcgtatcttacatagagaaccataaatcc tga

DBGET integrated database retrieval system