Caldimonas thermodepolymerans: IS481_07115 Help Entry IS481_07115       CDS       T06911                                  Symbol zapB Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism sthm  Caldimonas thermodepolymerans Brite KEGG Orthology (KO) [BR:sthm00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:sthm03036]     IS481_07115 (zapB) Chromosome and associated proteins [BR:sthm03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     IS481_07115 (zapB) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB TetR_C_31 CC_Bre1 Rod_CreS Cep57_CLD_2 ATG16 GAS Taxilin Rootletin DivIC DUF4763 T3SS_needle_E HMMR_C CENP-F_leu_zip Tropomyosin PCRF Nuf2_DHR10-like Mis12 FPP DUF7880 Takusan TPR_MLP1_2 YabA ATG14 TMF_DNA_bd APG6_N DUF4164 Motif Other DBs NCBI-ProteinID:  QPC32908 LinkDB All DBs Position complement(1486201..1486428) Genome browser AA seq 75 aa AA seqDB search MSQIDELVERVERLLVRYEELQRTNALLEQQLAGMTAERDSLRSRLNAARARIDALLERL PEPLAVPDPSDKEAG NT seq 228 nt NT seq  +upstreamnt  +downstreamnt atgtcacagatcgacgaactcgtggaacgcgtggaacgcctgctggtgcgctacgaggaa ctgcagcggaccaacgccctgctggaacagcagctcgcgggcatgacggccgagcgggac agcctgcgctcgcgcctgaacgccgcgcgggcccgcatcgacgcgctgctcgagcgcctg cccgagccgctcgccgttcccgatcccagcgacaaggaggccggatga

DBGET integrated database retrieval system