Streptomyces sp. PBH53: QR97_25225 Help Entry QR97_25225        CDS       T10303                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism stpb  Streptomyces sp. PBH53 Pathway stpb00998   Biosynthesis of various antibiotics stpb01100   Metabolic pathways stpb01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:stpb00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QR97_25225    00074 Mycolic acid biosynthesis     QR97_25225   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QR97_25225 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AKN72630 UniProt:  A0A0H4C764 LinkDB All DBs Position complement(5821470..5821733) Genome browser AA seq 87 aa AA seqDB search MDREAIVRALEAALTDVLERPVTGLSGEVRLFDDLHLDSTTMLEMLMALENSLGLIVDPE ELDADDFESVDTFTDFVQTTLRNQVPA NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atggaccgcgaggcgattgtgcgggcactggaagccgccctgaccgatgtgctggagcgc ccggtcaccggactgagcggcgaggtcaggctcttcgacgacctgcacctggactccacc accatgctggagatgctgatggccctggagaactccctgggcctgatcgtcgatccggag gaactggacgcggacgacttcgagtcggtggacaccttcaccgacttcgtccagaccacc ctgcgcaaccaggtgccggcgtga

DBGET integrated database retrieval system