Streptococcus sp. A12: ATM98_08795 Help Entry ATM98_08795       CDS       T05522                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism stra  Streptococcus sp. A12 Pathway stra01100   Metabolic pathways stra01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:stra00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ATM98_08795    00074 Mycolic acid biosynthesis     ATM98_08795   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ATM98_08795 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding TerB DUF6137 PRF Motif Other DBs NCBI-ProteinID:  AMP67805 LinkDB All DBs Position 1812789..1813013 Genome browser AA seq 74 aa AA seqDB search MAVFEKVQEIIVEELGKEPSEVTLESTFEDLEADSLDLFQVISEIEDAFDIQIETEEGLS TVGDLVAYVEEKTK NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atggcagtatttgaaaaagtacaagaaattatcgttgaagaacttggtaaagaaccatca gaagtaactcttgagtctacttttgaagatcttgaagctgattcattggatttgttccaa gtgatttcagaaattgaagatgcattcgacattcaaattgaaactgaagaaggattgtct actgtaggggaccttgttgcttacgtagaagaaaaaactaaataa

DBGET integrated database retrieval system