Streptacidiphilus sp. P02-A3a: GXP74_03135 Help Entry GXP74_03135       CDS       T08580                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism strh  Streptacidiphilus sp. P02-A3a Pathway strh00253   Tetracycline biosynthesis strh01056   Biosynthesis of type II polyketide backbone strh01100   Metabolic pathways strh01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:strh00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     GXP74_03135    00253 Tetracycline biosynthesis     GXP74_03135  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:strh01004]     GXP74_03135    01008 Polyketide biosynthesis proteins [BR:strh01008]     GXP74_03135 Lipid biosynthesis proteins [BR:strh01004]  Polyketide synthase   Component type    GXP74_03135 Polyketide biosynthesis proteins [BR:strh01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      GXP74_03135     Nonaketide PKS      GXP74_03135     Decaketide PKS      GXP74_03135 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding T4_Gp59_N Motif Other DBs NCBI-ProteinID:  QMU67352 LinkDB All DBs Position complement(666104..666361) Genome browser AA seq 85 aa AA seqDB search MAEQITVDDLRAILISCLGDDVEALHGDISDHTLDELGCDSLALLETVTKLELQHDAVLG EEEVTVASTLGQVLRLANERLRASA NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atggctgaacagatcacggtcgacgacctgcgcgcgatcctcatctcctgcctcggtgac gacgtcgaggcactgcacggcgacatctccgaccacaccctggacgaactcggctgcgac tcgctcgccctcctggagacggtgaccaagttggagttgcaacacgacgcggtcctcggc gaggaggaggtcacggtggcgtccaccttggggcaggtactgagactggcgaacgagcgg ctgcgggcgtcggcctag

DBGET integrated database retrieval system